Join us for hands on workshops on topics in Bioinformatics and Computational Biology. The first one is learning the Linux system. Check back at blogs.rochester.edu/compbio for more topics and information!
Category Archives: Meetings
2015 Department of Biology Retreat final question
Here is the final question for the UR Biology retreat trivia quiz:
Crack the code
Name the three faculty members associated with the sequence below. You may use any tool to answer this question.
GATGTCCATAAACGCCGTATGGCACAGGAGACGAAGACCGTGGCGACAGCCAAGTTTCGCTATTAG
Rochester Alums at the Fly Meetings
Many Rochester Alums met up at this year’s Fly Meetings in Chicago. We sure to like our Drosophila here at Rochester!
From Left to Right: David Loehlin, JP Masly, Nitin Phadnis, Rob Unckless, Amanda Larracuente, Andrea Betancourt, Colin Meiklejohn
Speciation Day, May 7, Cornell
Speciation Day will be an opportunity for researchers from Cornell, Syracuse, and Rochester to share their latest speciation research. The symposium will feature both talks and posters. Registration is currently open to groups at Cornell, Syracuse and Rochester. If you did not receive an invitation to participate, please consider contacting the event organizers through the links available at the registration page.
Rochester Students Sweep SSAR Awards
Two Rochester EEB students were recognized by the Society for the Study of Amphibians and Reptiles (SSAR) for outstanding research presentations at the Joint Meetings of Ichthyologists and Herpetologists (JMIH). Dan Scantlebury won the Henri Seibert Award in Evolution/Systematics for his presentation on “Patterns of adaptive radiation in West Indian dwarf geckos (Sphaerodactylidae: Sphaerodactylus).” Anthony Geneva’s poster on “A multi-locus molecular phylogeny of distichoid anoles” won best poster in the Evolution, Genetics, & Systematics category. Congrats to Dan and Anthony!
23rd Annual Genetics Day Friday, May 6, 2011
Dr. Steven Gill @ 10:00am, “The Oral Microbiota: A Role in Oral Cancer?”
Dr. John Jaenike @ 10:35am, “Endosymbiont-Mediated Defense Against Nematode Parasites”
Dr. Douglas Portman @ 11:45am, “Sex and the Single Neuron: Genetic Control of Behavior in the Nematode C. elegans”
Dr. Hartmut (Hucky) Land @ 12:20pm, “Cancer Cell Metabolism”
Dr. Keith Yamamoto @ 3pm, “Transcriptional Regulation by Steroids: Signal Integration and Gene Networks”
Lectures will be held in the Class of ’62 Auditorium.
Discussion on RADs
Next week, the Glor lab with special guest Dan McNabney will discuss a recent paper from the Andolfatto lab using a modified RAD sequencing protocol for genetic mapping. This method and techniques similar to it are becoming increasingly popular in population genomic and phylogenetic studies across a variety of taxa. The paper and method may be of interest to a number of labs here and all are welcome. We’ll meet in the Glor lab on Tuesday (4/19) at 2 pm, discussion of the paper will start around 2:30.
Vision Meeting Coming to Rochester
From Floridapfe's flickr stream (http://www.flickr.com/photos/floridapfe/)
EEB researchers may be interested in some of the talks at the Optical Society of America’s vision meeting, which will be held at the UR Medical Center in a couple of weeks. The first session covers comparative color vision across the animal kingdom, and a later talk assesses evolutionary models of color categorization. You can find the complete schedule and details on talks and presenters on the web. Speakers of interest include Nathaniel Dominy, Claude Desplan, Almut Kelber, Joseph Corbo and Kimberley A. Jameson. Oct 22/23 in the Class of ’62 Auditorium. – David Loehlin
